Applied Biosystems™ QuantStudio™ 5 Real-Time PCR System from Thermo Fisher Scientific

Product Specs
ItemApplied Biosystems™ QuantStudio™ 5 Real-Time PCR System
CompanyThermo Fisher Scientific
Price Get Pricing Get Quote for this Product
Catalog NumberA28573 / A28569 / A28138 / A28574 / A28139 / A28575
Dimensions(H x W x D) 40 x 27 x 50 cm
QuantityEA
ApplicationsGene expression, genotyping, genetic variation analysis, microbial detection, pathogen detection
Wells96 and 384 wells
Heating RateMaximum block ramp rate:
96-well 0.1 mL block: 9.0°C/sec
96-well 0.2 mL block: 6.5°C/sec
384-well block: 6.0°C/sec
Volume96-well 0.1 mL block: 10–30 µL
96-well 0.2 mL block: 10–100 µL
384-well block: 5–20 µL
Temperature Range4–99.9°C
TypeReal-Time PCR (qPCR) System
Throughput96 or 384 sample capacity (wells)
CompatibilityCompatible dyes: FAM™, SYBR™ Green, VIC™, JOE™, TET™, ABY™, NED™, TAMRA™, Cy®3, JUN™, ROX™, Texas Red™, Mustang Purple™, Cy®5, LIZ™, Cy®5.5

Features

Compatible with automation

Additional Product Information

Multiplexing:

96-well: up to 6 targets

384-well: up to 5 targets

Average sample ramp rate: 3.66°C/sec

Add to Compare List

Thermo Fisher Scientific

168 Third Avenue

Waltham, MA 02451

United States

Phone: 800-678-5599

Company Profile

Website: www.thermofisher.com

(1) Loss of two-pore channel 2 function in melanoma-derived tumours reduces tumour growth in vivo but greatly increases tumour-related toxicity in the organismCancer Cell IntDecember 16, 2023Ali Hanbashi, Moureq Alotaibi, Homood M. As Sobeai, Lama Binobaid, Khalid Alhazzani, Xuhui Jin, Faroq Kamli, Ali Alhoshani, John Parringtonwater (20 µl) was added to make up the total volume. The reaction mixture was then loaded onto the Applied Biosystems QuantStudio 5 Real-Time PCR System to measure expression relative to a housekeeping gene. The qPCR was performed with primers specific

(2) Cholesterol 25-Hydroxylase Suppresses Swine Acute Diarrhea Syndrome Coronavirus Infection by Blocking Spike Protein-Mediated Membrane FusionVirusesDecember 11, 2023Dakai Liu, Da Shi, Hongyan Shi, Liaoyuan Zhang, Jiyu Zhang, Miaomiao Zeng, Tingshuai Feng, Xiaoman Yang, Xin Zhang, Jianfei Chen, et al.cDNA Synthesis Mix (TaKaRa, Dalian, China). Quantitative real-time PCR (qRT-PCR) was conducted using the Applied Biosystems® QuantStudio® 5 Real-Time PCR System (Thermo Fisher, Waltham, MA, USA) with TB green® Premix Ex Taq™ II (Tli RnaseH Plus) (TaKaRa, Kusatsu-shi,

(3) CRISPR-Cas9 knockout screening identifies KIAA1429 as an essential gene in Ewing sarcomaJournal of Experimental & Clinical Cancer ResearchSeptember 28, 2023Kezhe Tan, Wenjie Lu, Feng Chen, Hao Shi, Yingxuan Ma, Zhou Chen, Wei Wu, Zhibao Lv, Jialin MoHigh-Capacity RNA-to-cDNA kit (Thermo Fisher Scientific, #4387406). Quantitative PCR was performed using an Applied Biosystems QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific, #A34322) with SYBR Green Master buffer (ROX) (Thermo Fisher Scientific, #A25742).

(4) Predicting response to immunotherapy in gastric cancer via assessing perineural invasion-mediated inflammation in tumor microenvironmentJ Exp Clin Cancer ResAugust 11, 2023Xunjun Li, Yiyun Wang, ZhongYa Zhai, Qingyi Mao, Dianjie Chen, Luxi Xiao, Shuai Xu, Qilin Wu, Keming Chen, Qiantong Hou, et al.protocol.Quantitative RT‒PCR gene expression analyses were performed with QuantStudio 5(Applied Biosystems,A28139).The primers were listed in Supplementary file 1. Gene expression data were normalized to GAPDH mRNA

(5) Kinin receptors regulate skeletal muscle regeneration: differential effects for B1 and B2 receptorsInflammation ResearchAugust 1, 2023Leonardo Martins, Weslley Wallace Amorim, Marcos Fernandes Gregnani, Ronaldo de Carvalho Araújo, Fatimunnisa Qadri, Michael Bader, João Bosco Pesquerotranscripts, the primers listed in Table S3 were used in the SYBR Green or TaqMan system on the device of The Applied Biosystems® QuantStudio® 5 Real-Time PCR System (Thermo Fisher, USA). Gapdh and Actb gene were used as internal control. Each biological sample had

(6) Polyphasic characterization of a novel hot-spring cyanobacterium Thermocoleostomius sinensis gen et sp. nov. and genomic insights into its carbon concentration mechanismFrontiers in MicrobiologyJuly 26, 2023Ying Jiang, Jie Tang, Xiangjian Liu, Maurycy Darochquantitative PCR reaction was done with TB Green Premix Ex Taq (Tli RnaseH Plus) (TaKaRa, Dalian, China) in an Applied Biosystems QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Waltham, America) using the following conditions: denaturation at 95°C for

(7) Opposing gene regulatory programs governing myofiber development and maturation revealed at single nucleus resolutionNature communicationsJuly 19, 2023Dos Santos M, Shah AM, Zhang Y, Bezprozvannaya S, Chen K, Xu L, Lin W, McAnally JR, Bassel-Duby R, Liu N, et al.assembled using PowerTrack SYBR Green Master Mix (Applied Biosystems). Assays were performed using Applied Biosystems QuantStudio 5 Real-Time PCR System (Applied Biosystems). Expression values were normalized to 18 S mRNA. Sequences of oligonucleotides

(8) Dexamethasone affects human fetal adrenal steroidogenesis and subsequent ACTH response in an ex vivo culture modelFront Endocrinol (Lausanne)July 6, 2023Cecilie Melau, Berta Gayete Mor, Malene Lundgaard Riis, John E. Nielsen, Eva Dreisler, Kasper Aaboe, Pia Tutein Brenøe, Lea Langhoff Thuesen, Kristine Juul Hare, Rod T. Mitchell, et al.MasterMix (Agilent Technologies, Santa Clara, CA). All experiments were setup in 384-well plates using the Applied Biosystems QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) and changes in gene expression quantified using the 2-ΔΔCt method (26). Expression

(9) MLL methyltransferases regulate H3K4 methylation to ensure CENP-A assembly at human centromeresPLOS BiologyJune 28, 2023Kausika Kumar Malik, Sreerama Chaitanya Sridhara, Kaisar Ahmad Lone, Payal Deepakbhai Katariya, Deepshika Pulimamidi, Shweta Tyagi(Thermo Fischer Scientific) according to the manufacturer’s protocol. RT-qPCR was performed in either 7500 Real-Time PCR (Applied Biosystems), QuantStudio 5 Real-Time PCR System (Applied bioscience), or Bio-Rad (CFX-maestro) using DyNAmo ColorFlash SYBR Green qPCR kit (Thermo Fisher Scientific

(10) Single-swap editing for the correction of common Duchenne muscular dystrophy mutationsMolecular Therapy - Nucleic AcidsJune 13, 2023Andreas C. Chai, Francesco Chemello, Hui Li, Takahiko Nishiyama, Kenian Chen, Yu Zhang, Efraín Sánchez-Ortiz, Adeeb Alomar, Lin Xu, Ning Liu, et al.43–46–47) normalized to total Dmd transcript expression (includes exons 39–41). Assays were performed using Applied Biosystems QuantStudio 5 real-time PCR System (Applied Biosystems). For RT-PCR analysis, target exons were PCR amplified from cDNA using GoTaq polymerase

(11) Autolysosomal exocytosis of lipids protect neurons from ferroptosisJournal of Cell BiologyJune 5, 2023Isha Ralhan, Jinlan Chang, Matthew J. Moulton, Lindsey D. Goodman, Nathanael Y.J. Lee, Greg Plummer, H. Amalia Pasolli, Doreen Matthies, Hugo J. Bellen, Maria S. Ioannou(Thermo Fisher Scientific). Mean fold change was determined using the ΔΔCt method from data collected using an Applied Biosystems’ QuantStudio 5 Real-Time PCR system. All primers used are listed in the key resource table and are intron spanning with 90–110% efficiency

(12) The Effect of Statins on Male Reproductive Parameters: A Mechanism Involving Dysregulation of Gonadal Hormone Receptors and TRPV1International Journal of Molecular SciencesMay 25, 2023Temidayo S. Omolaoye, Asha C. Cyril, Rajan Radhakrishnan, Surendra Singh Rawat, Noushad Karuvantevida, Stefan S. du PlessisTable 1. Quantitative RT-PCR was performed in duplicate in a QuantStudio™ 5 System (Applied Biosystems™ A28139, Waltham, MA, USA). Data were analyzed using the QuantStudio™ Design & Analysis Software v1.4.1, and

(13) Mucin 4 Confers Gemcitabine Resistance and an Unfavorable Prognosis in Patients with Cholangiocarcinoma via AKT ActivationInternational Journal of Biological SciencesMay 21, 2023Yi-Ru Pan, Chiao-En Wu, Shih-Ming Jung, Shih-Chiang Huang, Sheng-Hsuan Lin, Wen-Chi Chou, Yu-Chan Chang, Ming-Huang Chen, Tsai-Hsien Hung, Alice L. Yu, et al.Waltham, MA) and 0.5 µM forward and reverse primers (Table S4). The product was amplified using an Applied Biosystems QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Inc., Waltham, MA). Colony formation assay SNU-1196-GR cells (500 cells/well)

(14) Highly sensitive droplet digital PCR for detection of RET fusion in papillary thyroid cancerBMC CancerApril 20, 2023Mengke Chen, Junyu Xue, Ye Sang, Wenting Jiang, Weiman He, Shubin Hong, Weiming Lv, Haipeng Xiao, Rengyun Liureaction was performed using TaqMan® Fast Advanced Master Mix (#4,444,557, Applied Biosystems) and by the Applied Biosystems QuantStudio 5 Real-Time PCR System under the following program: preincubated at 50 °C for 10 min and 95 °C for 2 min; followed 40 cycles

(15) Leishmania Infection-Induced Proteolytic Processing of SIRPα in MacrophagesPathogensApril 13, 2023Hana Hirai, Jing Hong, Wataru Fujii, Chizu Sanjoba, Yasuyuki Gotoreverse transcription PCR product as the template and 10 µL of SYBR Select Master Mix (Thermo) with the Applied Biosystems QuantStudio 5 Real-Time PCR System (Thermo). Data were analyzed with 2−ΔΔCt methods through normalization with Actb. The thermal cycling

(16) Hpgd affects the progression of hypoxic pulmonary hypertension by regulating vascular remodelingBMC Pulmonary MedicineApril 13, 2023Meng He, Kelong Tao, Min Xiang, Jian SunACAGTTTCACATTCCCACCCATCAG; GAPDH-F: GATCATCAGCAATGCCTCCT; GAPDH-R: TGTGGTCATGAGTCCTTCCA. The qRT-PCR (#A28139) instrument was purchased from Thermo Fisher. Assessment of the proliferation and apoptosis of hPAECs According

(17) PRpnp , a novel dual activity PNP family protein improves plant vigour and confers multiple stress tolerance in Citrus aurantifoliaPlant Biotechnology JournalApril 1, 2023Sweta Singh, Chanderkant Chaudhary, Rushikesh D. Bharsakale, Snehi Gazal, Lokesh Verma, Zeba Tarannum, Ganesh T. Behere, Jitender Giri, Hugo Germain, Dilip K. Ghosh, et al.SYBR Green dye (A25741; Applied Biosystems™, Waltham, MA) and QuantStudio™ 5 real‐time PCR system (A28574; Applied Biosystems™). QuantStudio™ Design and Analysis Desktop Software v1.5.1 was used for analysis.

(18) IL-1β contributes to the secretion of sclerostin by osteocytes and targeting sclerostin promotes spinal fusion at early stagesJournal of orthopaedic surgery and researchMarch 3, 2023Jiang Z, Jin L, Jiang C, Yan Z, Cao Y.Master Mix (Thermo Fisher Scientific, Inc.). Quantitative PCR amplification was performed using an Applied Biosystems QuantStudio 5 Real-Time PCR System with qPCR Master Mix Kit and the following thermocycling conditions: melting at 95 °C for 10 s, annealing

(19) An RNA stem-loop functions in conjunction with an upstream open reading frame to direct preferential translation in the integrated stress responseThe Journal of biological chemistryFebruary 1, 2023Amin PH, Carlson KR, Wek RC.PCR amplification was carried out by PowerUp SYBR Green master mix (Thermo Fisher Scientific, Cat# A25742) using an Applied Biosystems QuantStudio 5 Real-Time PCR system. The primers specific for the targets are mentioned in the Table S1. The relative abundance for each

(20) Single-cell transcriptome analysis reveals the metabolic changes and the prognostic value of malignant hepatocyte subpopulations and predict new therapeutic agents for hepatocellular carcinomaFrontiers in OncologyJanuary 31, 2023Cuifang Han, Jiaru Chen, Jing Huang, Riting Zhu, Jincheng Zeng, Hongbing Yu, Zhiwei He(cDNA) was synthesized and PCRs with cDNA as template were performed using a real-time detector (The Applied Biosystems QuantStudio 5 Real-Time PCR System) using Hieff qPCR SYBR Green Master Mix. The primer sequences are shown in Supplementary Table S1 .

Be the First to Write a Review!